ID: 1129937701_1129937704

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1129937701 1129937704
Species Human (GRCh38) Human (GRCh38)
Location 15:79464441-79464463 15:79464457-79464479
Sequence CCATCTTCAGTTTACAAATGAGG AATGAGGAAATCGAGGCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 20, 3: 92, 4: 562} {0: 1, 1: 0, 2: 7, 3: 123, 4: 643}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!