ID: 1129983712_1129983720

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1129983712 1129983720
Species Human (GRCh38) Human (GRCh38)
Location 15:79897291-79897313 15:79897316-79897338
Sequence CCGGGACCGCGGAGGCGGCAGCG ACTGGCGGGGATGGTAAAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 511} {0: 1, 1: 0, 2: 2, 3: 9, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!