ID: 1130062194_1130062197

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1130062194 1130062197
Species Human (GRCh38) Human (GRCh38)
Location 15:80578105-80578127 15:80578140-80578162
Sequence CCTGGGTGCTCATGTTCATGGGG TTGCTGCTTGTCCTCCACTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 145} {0: 1, 1: 0, 2: 1, 3: 17, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!