ID: 1130092990_1130092993

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1130092990 1130092993
Species Human (GRCh38) Human (GRCh38)
Location 15:80836820-80836842 15:80836861-80836883
Sequence CCAGGACCAGAGCAGTAGGAAGT GCAAGGCAGAATAATGTGATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 175} {0: 1, 1: 1, 2: 1, 3: 28, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!