ID: 1130099142_1130099152

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1130099142 1130099152
Species Human (GRCh38) Human (GRCh38)
Location 15:80878892-80878914 15:80878933-80878955
Sequence CCCTCTTCCCTCCACTGCCCCAG CAGGTTGCCATGAGCTCAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 143, 4: 999} {0: 1, 1: 0, 2: 13, 3: 364, 4: 5940}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!