ID: 1130115534_1130115546

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1130115534 1130115546
Species Human (GRCh38) Human (GRCh38)
Location 15:81001856-81001878 15:81001885-81001907
Sequence CCGCCCTCCCCGCTCCGAGGGCC GGCCATGCCCAAGAAGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 451} {0: 1, 1: 0, 2: 1, 3: 13, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!