ID: 1130141959_1130141969

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1130141959 1130141969
Species Human (GRCh38) Human (GRCh38)
Location 15:81235116-81235138 15:81235166-81235188
Sequence CCTTGAACTGTGCATACCAGTGG CAGAGAAAAGATAAGGTTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 114} {0: 1, 1: 0, 2: 1, 3: 37, 4: 447}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!