ID: 1130142861_1130142873

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1130142861 1130142873
Species Human (GRCh38) Human (GRCh38)
Location 15:81245545-81245567 15:81245594-81245616
Sequence CCGGGTTGGAGTAAGTTGTTACT CTGCTGGCATGGGTGGGACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 156} {0: 1, 1: 0, 2: 3, 3: 39, 4: 336}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!