ID: 1130146956_1130146959

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1130146956 1130146959
Species Human (GRCh38) Human (GRCh38)
Location 15:81281656-81281678 15:81281673-81281695
Sequence CCCTCATAATCCTGGGCTTCCAT TTCCATAGCCCTCCCTGCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 178} {0: 1, 1: 0, 2: 0, 3: 9, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!