ID: 1130148194_1130148212

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1130148194 1130148212
Species Human (GRCh38) Human (GRCh38)
Location 15:81291682-81291704 15:81291730-81291752
Sequence CCCTAGTGCTGGAAACTAGGGTA TAATGGGGAGGGAGGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 85} {0: 1, 1: 2, 2: 45, 3: 505, 4: 4052}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!