ID: 1130243378_1130243386

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1130243378 1130243386
Species Human (GRCh38) Human (GRCh38)
Location 15:82219722-82219744 15:82219769-82219791
Sequence CCACTGAACACCCGAGCAAATGC TTCCTGGAGCACAGGTTTAGGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 4, 4: 82} {0: 1, 1: 1, 2: 3, 3: 16, 4: 302}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!