ID: 1130246709_1130246719

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1130246709 1130246719
Species Human (GRCh38) Human (GRCh38)
Location 15:82258012-82258034 15:82258046-82258068
Sequence CCAGCTTCCCTCCCAACCCACAC AATCGATCTTCAAGTCTATTGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 6, 3: 93, 4: 898} {0: 1, 1: 0, 2: 0, 3: 7, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!