ID: 1130283871_1130283881

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1130283871 1130283881
Species Human (GRCh38) Human (GRCh38)
Location 15:82540062-82540084 15:82540108-82540130
Sequence CCCAGGCGCGTGTAGTACTTTTC TCACGGTTTTGGTGCGAACGCGG
Strand - +
Off-target summary {0: 2, 1: 4, 2: 4, 3: 2, 4: 29} {0: 1, 1: 2, 2: 3, 3: 2, 4: 15}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!