ID: 1130284117_1130284127

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1130284117 1130284127
Species Human (GRCh38) Human (GRCh38)
Location 15:82541224-82541246 15:82541259-82541281
Sequence CCGCACCCATCCTCAAACCAGGG ACCAGCGCAGGCTGCCCCGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 297} {0: 1, 1: 0, 2: 0, 3: 6, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!