ID: 1130334049_1130334063

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1130334049 1130334063
Species Human (GRCh38) Human (GRCh38)
Location 15:82943676-82943698 15:82943722-82943744
Sequence CCCTGTGGATACCGCCCACCCCA CAGAACAAAAGGAGGACTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 110} {0: 1, 1: 0, 2: 2, 3: 25, 4: 344}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!