ID: 1130336246_1130336250

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1130336246 1130336250
Species Human (GRCh38) Human (GRCh38)
Location 15:82959394-82959416 15:82959437-82959459
Sequence CCATTGGCATGCACAGAGTGGCT AGGCAGAGCACAGTCATTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 196} {0: 1, 1: 0, 2: 9, 3: 54, 4: 302}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!