ID: 1130348025_1130348026

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1130348025 1130348026
Species Human (GRCh38) Human (GRCh38)
Location 15:83066956-83066978 15:83066978-83067000
Sequence CCGAGTTGAAGAGGAAGGCGAAG GCGCTCCTTCAGCGACGCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 184} {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!