ID: 1130462982_1130462990

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1130462982 1130462990
Species Human (GRCh38) Human (GRCh38)
Location 15:84172574-84172596 15:84172591-84172613
Sequence CCGCCGAAACGGGTGCGCAGGGG CAGGGGGCGCGCGGGTTGAGGGG
Strand - +
Off-target summary {0: 6, 1: 0, 2: 1, 3: 1, 4: 32} {0: 4, 1: 2, 2: 0, 3: 12, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!