|
Left Crispr |
Right Crispr |
Crispr ID |
1130472284 |
1130472289 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
15:84236080-84236102
|
15:84236102-84236124
|
Sequence |
CCTTCAGCAAGCAGCCCAGTCCC |
CTGCCCTTGCCAATCACCCCAGG |
Strand |
- |
+ |
Off-target summary |
{0: 11, 1: 12, 2: 14, 3: 24, 4: 270} |
{0: 9, 1: 1, 2: 23, 3: 28, 4: 222} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|