ID: 1130541940_1130541951

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1130541940 1130541951
Species Human (GRCh38) Human (GRCh38)
Location 15:84826756-84826778 15:84826803-84826825
Sequence CCTGGAGCAGCCAACCATGTTTC TGGAGCAGGGGAGCCACAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 131} {0: 1, 1: 1, 2: 8, 3: 57, 4: 432}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!