ID: 1130590812_1130590822

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1130590812 1130590822
Species Human (GRCh38) Human (GRCh38)
Location 15:85209354-85209376 15:85209392-85209414
Sequence CCCCTTGTTGGCCCATGCCAGGA CTTCTCCATGGCCCCCTGCAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!