ID: 1130718592_1130718599

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1130718592 1130718599
Species Human (GRCh38) Human (GRCh38)
Location 15:86363193-86363215 15:86363240-86363262
Sequence CCTACAAAGGCACTTTTGTCTGC TTGTGTGGGCAGATGCAAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 308} {0: 1, 1: 0, 2: 1, 3: 6, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!