ID: 1130765640_1130765641

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1130765640 1130765641
Species Human (GRCh38) Human (GRCh38)
Location 15:86868020-86868042 15:86868044-86868066
Sequence CCAAGAGATGTCAGATTGTGTAT TTTTACAGTTTTTCAAAATAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 161} {0: 1, 1: 1, 2: 10, 3: 98, 4: 1076}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!