ID: 1130863486_1130863488

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1130863486 1130863488
Species Human (GRCh38) Human (GRCh38)
Location 15:87911489-87911511 15:87911511-87911533
Sequence CCACTATCTTGTAGGACGGTCTG GTTCCATTTTCACACAATAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 39} {0: 1, 1: 0, 2: 2, 3: 13, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!