ID: 1130897682_1130897684

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1130897682 1130897684
Species Human (GRCh38) Human (GRCh38)
Location 15:88183666-88183688 15:88183679-88183701
Sequence CCTGGGCTCACACGCCCCAGGGC GCCCCAGGGCCCCGTGAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 298} {0: 1, 1: 0, 2: 2, 3: 39, 4: 443}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!