ID: 1130954996_1130955003

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1130954996 1130955003
Species Human (GRCh38) Human (GRCh38)
Location 15:88621397-88621419 15:88621422-88621444
Sequence CCTGCACCGGGGCGGCGGGGTCG CGGGCTGAGGCCGCGTGTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 148} {0: 1, 1: 0, 2: 0, 3: 14, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!