ID: 1131027668_1131027677

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1131027668 1131027677
Species Human (GRCh38) Human (GRCh38)
Location 15:89158449-89158471 15:89158502-89158524
Sequence CCAGCAGCTGAAGAGCAGAGAAG GAGTACCTGGGTCAGGAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 415} {0: 1, 1: 0, 2: 1, 3: 27, 4: 262}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!