ID: 1131113057_1131113063

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1131113057 1131113063
Species Human (GRCh38) Human (GRCh38)
Location 15:89777104-89777126 15:89777127-89777149
Sequence CCCTTACTGCCCCAAGATACAGT CGCCCCCGTATTCGTCCCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 113} {0: 1, 1: 0, 2: 0, 3: 0, 4: 13}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!