ID: 1131126862_1131126870

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1131126862 1131126870
Species Human (GRCh38) Human (GRCh38)
Location 15:89866301-89866323 15:89866325-89866347
Sequence CCACGTTGCCTAGACAATGAACT GCTTAGACTAGGGGGTTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 69} {0: 1, 1: 0, 2: 4, 3: 13, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!