ID: 1131172021_1131172025

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1131172021 1131172025
Species Human (GRCh38) Human (GRCh38)
Location 15:90185252-90185274 15:90185266-90185288
Sequence CCGGGGAGCCTGTTGCCATGGCA GCCATGGCAGCGCAGGAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 31, 4: 248} {0: 1, 1: 0, 2: 3, 3: 42, 4: 355}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!