ID: 1131172910_1131172926

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1131172910 1131172926
Species Human (GRCh38) Human (GRCh38)
Location 15:90191161-90191183 15:90191196-90191218
Sequence CCCCTCCCAGGGAGTGGCCAGCT GGCCCCAGTGGGGGTGGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 283} {0: 1, 1: 0, 2: 6, 3: 68, 4: 501}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!