ID: 1131179556_1131179561

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1131179556 1131179561
Species Human (GRCh38) Human (GRCh38)
Location 15:90230641-90230663 15:90230660-90230682
Sequence CCCCGAGACATCCAGAGGGAGCT AGCTTTCTGGACCCACACACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 111} {0: 1, 1: 0, 2: 0, 3: 14, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!