ID: 1131215292_1131215304

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1131215292 1131215304
Species Human (GRCh38) Human (GRCh38)
Location 15:90530518-90530540 15:90530554-90530576
Sequence CCCGAGAGGAAATCGCAAACAGC GGGTGGCGCGGCGCGGCTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 72} {0: 1, 1: 0, 2: 1, 3: 23, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!