ID: 1131218886_1131218889

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1131218886 1131218889
Species Human (GRCh38) Human (GRCh38)
Location 15:90564294-90564316 15:90564344-90564366
Sequence CCAGAGTATTTCTTGAAGAAAAA GTTAACCCTATGACATCATTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 60, 4: 564} {0: 1, 1: 0, 2: 0, 3: 2, 4: 71}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!