ID: 1131220983_1131220988

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1131220983 1131220988
Species Human (GRCh38) Human (GRCh38)
Location 15:90583940-90583962 15:90583971-90583993
Sequence CCATTTAACCCCAAGGCAGTGTG GCAGCCCCTTTGTTGTGGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 100} {0: 1, 1: 0, 2: 1, 3: 17, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!