ID: 1131228215_1131228223

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1131228215 1131228223
Species Human (GRCh38) Human (GRCh38)
Location 15:90642527-90642549 15:90642544-90642566
Sequence CCGAAGGCGGGCCCGGAGTGGGA GTGGGAGGCTCGGCCTGGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 88} {0: 1, 1: 1, 2: 4, 3: 56, 4: 533}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!