ID: 1131268961_1131268977

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1131268961 1131268977
Species Human (GRCh38) Human (GRCh38)
Location 15:90935170-90935192 15:90935215-90935237
Sequence CCCCTGCCCGGGCGCGCTCCCTC CCCACCTCCGACGCAAGAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 455} {0: 1, 1: 0, 2: 0, 3: 5, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!