ID: 1131373683_1131373691

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1131373683 1131373691
Species Human (GRCh38) Human (GRCh38)
Location 15:91905929-91905951 15:91905950-91905972
Sequence CCCCAAGTCGGGCCACCTTGCTG TGACGCAGGGGCACAGTGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 69} {0: 1, 1: 0, 2: 1, 3: 11, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!