ID: 1131375011_1131375015

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1131375011 1131375015
Species Human (GRCh38) Human (GRCh38)
Location 15:91916133-91916155 15:91916160-91916182
Sequence CCTGATCGGCTGCGGCGGCATCG GGCGCTGGGCGCGCTGCTGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 50} {0: 1, 1: 0, 2: 2, 3: 23, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!