ID: 1131464009_1131464012

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1131464009 1131464012
Species Human (GRCh38) Human (GRCh38)
Location 15:92640098-92640120 15:92640116-92640138
Sequence CCACCCATATCTCACACTTTGTA TTGTATCAGCATAAATTAGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 189} {0: 1, 1: 0, 2: 0, 3: 11, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!