ID: 1131478435_1131478438

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1131478435 1131478438
Species Human (GRCh38) Human (GRCh38)
Location 15:92761645-92761667 15:92761692-92761714
Sequence CCTACAATTAGACCTAGTAGCTG CAGTAGCAGCAGAAGCCTAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 73} {0: 1, 1: 0, 2: 2, 3: 22, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!