ID: 1131512118_1131512123

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1131512118 1131512123
Species Human (GRCh38) Human (GRCh38)
Location 15:93055235-93055257 15:93055275-93055297
Sequence CCAAAGTAGAGGAAAGAACACTG GGTCCCACTGCAACACAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 259} {0: 1, 1: 0, 2: 0, 3: 22, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!