ID: 1131515918_1131515921

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1131515918 1131515921
Species Human (GRCh38) Human (GRCh38)
Location 15:93076710-93076732 15:93076723-93076745
Sequence CCATCCTCATTTTGCAGATGAAG GCAGATGAAGAAACTGAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 9, 2: 42, 3: 232, 4: 887} {0: 5, 1: 26, 2: 146, 3: 398, 4: 1368}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!