ID: 1131635970_1131635972

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1131635970 1131635972
Species Human (GRCh38) Human (GRCh38)
Location 15:94233374-94233396 15:94233400-94233422
Sequence CCAATTAATAAAATTGCATATAT CTCTCTGTGTTATACATGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 57, 4: 676} {0: 1, 1: 0, 2: 2, 3: 13, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!