ID: 1131642483_1131642488

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1131642483 1131642488
Species Human (GRCh38) Human (GRCh38)
Location 15:94307427-94307449 15:94307448-94307470
Sequence CCCAGGGTAGCAGGAGTGTCCCT CTGATGTTTCAGGAAGAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 140} {0: 1, 1: 0, 2: 1, 3: 32, 4: 328}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!