ID: 1131650974_1131650982

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1131650974 1131650982
Species Human (GRCh38) Human (GRCh38)
Location 15:94399427-94399449 15:94399448-94399470
Sequence CCTCTGACCCTCAGTTTATTCCC CCTGTAAAATGGGGCTAAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 30, 4: 417} {0: 1, 1: 1, 2: 4, 3: 65, 4: 315}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!