ID: 1131653384_1131653389

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1131653384 1131653389
Species Human (GRCh38) Human (GRCh38)
Location 15:94427459-94427481 15:94427476-94427498
Sequence CCATGTCTTACCATGGTGGGGCT GGGGCTGGAGGGAGACAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 5, 4: 100} {0: 1, 1: 1, 2: 11, 3: 122, 4: 1127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!