ID: 1131753654_1131753662

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1131753654 1131753662
Species Human (GRCh38) Human (GRCh38)
Location 15:95537338-95537360 15:95537386-95537408
Sequence CCCTGCCAGTCCTGGTTCTTGCT CCTGGCACTCCACAGATACCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 15, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!