ID: 1131786219_1131786229

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1131786219 1131786229
Species Human (GRCh38) Human (GRCh38)
Location 15:95913982-95914004 15:95914003-95914025
Sequence CCAACATATCCACTCTTTATCCA CACTGTGTAGGGAGGGGGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 52, 4: 615}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!