ID: 1132055795_1132055803

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1132055795 1132055803
Species Human (GRCh38) Human (GRCh38)
Location 15:98649415-98649437 15:98649446-98649468
Sequence CCGGCGGCGCCGCCTTCGGAGTA TTCGCCCTTGTTTTTGGAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 36} {0: 1, 1: 0, 2: 0, 3: 9, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!